histamine (Cayman Chemical)

Cayman Chemical is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Cayman Chemical histamine
Histamine, supplied by Cayman Chemical, used in various techniques. Bioz Stars score: 95/100, based on 73 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/histamine+eia+kits/Histamine+EIA+Kit/pmc12513082-297-21-22
Average 95 stars, based on 73 article reviews

histamine - by Bioz Stars, 2026-10

95/100 stars

Images

Sequencing:

Article Title: Inhibition of mast cell degranulation with cromolyn sodium exhibits organ-specific effects in polycystic kidney (PCK) rats
Article Snippet: .. Primers utilized in this study are found in . table ft1 table-wrap mode="anchored" t5 caption a7 Gene name Sequence Source Forward primer Reverse primer Cma1 NCBI CACTGTGCAGGACGGTCTAT TTGAAGTTGGCCGAGAGTGG Tpsab 62 ACATCTGAGTGTTGCGCTGAAGCA CCCAACAGGTTGTGGTGTGCAGAAT Fcer1I NCBI GCTACCACTGCACAGGCTAT AACCCAGTGTCCACAGCAAA Acta2 63 AGCTCTGGTGTGTGACAATGG GGAGCATCATCACCAGCAAAG Col1a1 64 TGAGCCAGCAGATTGAGAAC TGATGGCATCCAGGTTGCAG Hrh1 NCBI CAGACCTGATTGTAGGGGCAG CATAGAGAGCCAAAAGAGGCAG Hrh2 NCBI CCCAATGGCACGGTTCATTC GCCGACGATTCAAGCTGACA F2rl1 NCBI AGTCCGTCATGGCTTTGTCA CTCGCCTCTGCGGTTCTGTG Open in a separate window Primers used for real-time PCR transcript analysis Serum histamine, tryptase, and renin measurement Histamine release was measured in serum by histamine EIA kits following the manufacturer’s instruction (Cayman Chemical, Ann Arbor, MI). .. Tryptase release was measured in serum by rat TPS ELISA kit (Neo Scientific, Cambridge, MA).

Real-time Polymerase Chain Reaction:

Enzyme-linked Immunosorbent Assay:

Article Title: Inhibition of mast cell-derived histamine secretion by cromolyn sodium treatment decreases biliary hyperplasia in cholestatic rodents.
Article Snippet: The commercially available kits for immunohistochemistry (IHC) were purchased from Vector Laboratories (Burlingame, CA, USA). .. Histamine EIA kits were purchased from Cayman Chemical (Ann Arbor, MI, USA). .. All primers and reagents for real-time PCR were purchased from SABiosciences (Fredrick, MD, USA).

Article Title: Inhibition of mast cell-secreted histamine decreases biliary proliferation and fibrosis in primary sclerosing cholangitis Mdr2 −/− mice
Article Snippet: Antibodies for immunoblotting, immunohistochemistry and immunofluorescence were purchased from Santa Cruz Biotechnology (Dallas, TX). .. Histamine EIA kits were purchased from Cayman Chemical (An Arbor, MI, USA). ..

Article Title: Inhibition of mast cell-derived histamine secretion by cromolyn sodium treatment decreases biliary hyperplasia in cholestatic rodents.
Article Snippet: .. Histamine secretion was measured in serum by commercially available histamine EIA kits (Cayman Chemical, Ann Arbor, MI, USA).7,32 In Vitro Analysis Cell culture In vitro, we utilized a mast cell line derived from fetal mouse liver (Amerian Type Culture Collection (ATCC), Manassas, VA, USA) and cultured murine cholangiocytes that were SV-40 transformed.38 All cells were maintained according to previous protocols39,40 or ATCC recommendations. ..

Article Title: Inhibition of mast cell degranulation with cromolyn sodium exhibits organ-specific effects in polycystic kidney (PCK) rats
Article Snippet: .. Histamine release was measured in serum by histamine EIA kits following the manufacturer’s instruction (Cayman Chemical, Ann Arbor, MI). .. Tryptase release was measured in serum by rat TPS ELISA kit (Neo Scientific, Cambridge, MA).

Article Title: Ursodeoxycholate inhibits mast cell activation and reverses biliary injury and fibrosis in Mdr2 −/− mice and human primary sclerosing cholangitis
Article Snippet: Antibodies for immunohistochemistry and immunofluorescence were purchased from Abcam (Cambridge, MA) or Santa Cruz (Dallas, TX). .. Histamine EIA kits were purchased from Cayman Chemical (An Arbor, MI) . .. The apical sodium-bile acid transporter (ASBT) inhibitor was obtained from Tocris Bioscience (Minneapolis, MN) and the farnesoid X receptor (FXRβ) inhibitor was obtained from Sigma-Aldrich Co (St. Louis, MO).

Article Title: Isolation and characterization of hepatic mast cells from cholestatic rats
Article Snippet: Primers and PCR reagents were obtained from Qiagen (SABiosciences, Valencia, CA) and Bio-Rad. .. Histamine EIA kits were obtained from Cayman Chemical (Ann Arbor, MI)( , ). .. The antibody, Anti-Rat Mast Cells, clone AR32AA4 (MAb AA4) used to isolate hepatic mast cells was purchased from BD Biosciences (San Jose, CA), this antibody has been used by other groups to isolate mature mast cells from bone marrow and the peritoneal cavity( , ).

In Vitro:

Article Title: Inhibition of mast cell-derived histamine secretion by cromolyn sodium treatment decreases biliary hyperplasia in cholestatic rodents.
Article Snippet: .. Histamine secretion was measured in serum by commercially available histamine EIA kits (Cayman Chemical, Ann Arbor, MI, USA).7,32 In Vitro Analysis Cell culture In vitro, we utilized a mast cell line derived from fetal mouse liver (Amerian Type Culture Collection (ATCC), Manassas, VA, USA) and cultured murine cholangiocytes that were SV-40 transformed.38 All cells were maintained according to previous protocols39,40 or ATCC recommendations. ..

Cell Culture:

Article Title: Inhibition of mast cell-derived histamine secretion by cromolyn sodium treatment decreases biliary hyperplasia in cholestatic rodents.
Article Snippet: .. Histamine secretion was measured in serum by commercially available histamine EIA kits (Cayman Chemical, Ann Arbor, MI, USA).7,32 In Vitro Analysis Cell culture In vitro, we utilized a mast cell line derived from fetal mouse liver (Amerian Type Culture Collection (ATCC), Manassas, VA, USA) and cultured murine cholangiocytes that were SV-40 transformed.38 All cells were maintained according to previous protocols39,40 or ATCC recommendations. ..

Derivative Assay:

Article Title: Inhibition of mast cell-derived histamine secretion by cromolyn sodium treatment decreases biliary hyperplasia in cholestatic rodents.
Article Snippet: .. Histamine secretion was measured in serum by commercially available histamine EIA kits (Cayman Chemical, Ann Arbor, MI, USA).7,32 In Vitro Analysis Cell culture In vitro, we utilized a mast cell line derived from fetal mouse liver (Amerian Type Culture Collection (ATCC), Manassas, VA, USA) and cultured murine cholangiocytes that were SV-40 transformed.38 All cells were maintained according to previous protocols39,40 or ATCC recommendations. ..

Transformation Assay:

Article Title: Inhibition of mast cell-derived histamine secretion by cromolyn sodium treatment decreases biliary hyperplasia in cholestatic rodents.
Article Snippet: .. Histamine secretion was measured in serum by commercially available histamine EIA kits (Cayman Chemical, Ann Arbor, MI, USA).7,32 In Vitro Analysis Cell culture In vitro, we utilized a mast cell line derived from fetal mouse liver (Amerian Type Culture Collection (ATCC), Manassas, VA, USA) and cultured murine cholangiocytes that were SV-40 transformed.38 All cells were maintained according to previous protocols39,40 or ATCC recommendations. ..

Review